
Also found in: Medical, Encyclopedia, Wikipedia.


A calcium-binding protein that mediates many metabolic processes, such as contraction of smooth muscle, by binding to enzymes and other proteins.

American Heritage® Dictionary of the English Language, Fifth Edition. Copyright © 2016 by Houghton Mifflin Harcourt Publishing Company. Published by Houghton Mifflin Harcourt Publishing Company. All rights reserved.


(Biochemistry) biochem a protein found in most living cells; it regulates many enzymic processes that are dependent on calcium
[from cal(cium) + modul(ate) + -in]
Collins English Dictionary – Complete and Unabridged, 12th Edition 2014 © HarperCollins Publishers 1991, 1994, 1998, 2000, 2003, 2006, 2007, 2009, 2011, 2014


(kælˈmɒdʒ ə lɪn)

a protein, present in most cells, that binds calcium and participates in many physiological functions.
[1975–80; cal (cium) + modul (ate) + -in1]
Random House Kernerman Webster's College Dictionary, © 2010 K Dictionaries Ltd. Copyright 2005, 1997, 1991 by Random House, Inc. All rights reserved.


n. calmodulina, proteína que se fija a los iones de calcio, interviene en procesos celulares y modifica enzimas sensitivas al calcio.
English-Spanish Medical Dictionary © Farlex 2012
Mentioned in ?
References in periodicals archive ?
Another two SNPs were located on the positions of 1.39 Mb and 2.71 Mb of chromosome 8 respectively, with the first SNP locating on the 14th intron of calmodulin regulated spectrin associated protein family member 2 (CAMSAP2) and the other locating on the 4th intron of potassium sodium-activated channel subfamily T member 2 (KCNT2).
Calmodulin is a structurally conserved and functionally preserved protein that is encoded by the CALM3 gene.
Investigating the disorder-order transition of calmodulin binding domain upon binding calmodulin using molecular dynamics simulation.
For individual 1083, calmodulin 3 (CALM3) and phospholamban (PLN) were differentially expressed following treatment with isoproterenol.
The PCR reaction amplified the regions ITS1-5,8S-ITS2 of ribosomal DNA, partial P-tubulin gene, and partial calmodulin gene with the following pairs of primers: ITS1 5'TCCGTAGGTGAACCTGCGG3' and ITS4 5'TCCTCCGCTTATTGATATGC3' (White et al., 1990), Bt2a 5'GGTAACCAAATCGGTGCTGCTTTC3' and Bt2b 5ACCCTCAGTGTAGTGACCCTTGGC3' (Glass and Donaldson, 1995), and CL1 5'GARTWCAAGGAGGCCTTCTC3', and CL2A 5'TTTTGCATCATGAGTTGGAC3' (Mule et al., 2004), respectively.
These higher-molecular-weight bands might represent fusion proteins comprising neurogranin, calmodulin, and other calmodulin-binding proteins (30).
Rapid recovery is Ca and calmodulin dependent, (26) and it has been shown that Munc13-1, which has a calmodulin binding site, is responsible for rapid recovery from depletion (43) (see also Fig.
Expression and Purification of CaMKII and Calmodulin. Recombinant human CaMKII[delta] (NCBI RefSeq: NP_742113.1) with an N-terminal 6xHN tag was integrated into a baculoviral construct (BacPAK9-6xHN), amplified in Sf9 insect cells (expression systems), and expressed in Hi5 (T.
Anderson, "The role of calmodulin kinase II in myocardial physiology and disease," Physiology, vol.