cyclooxygenase-1


Also found in: Thesaurus, Wikipedia.
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun1.cyclooxygenase-1 - an enzyme that regulates prostaglandins that are important for the health of the stomach lining and kidneys; "an unfortunate side effect of NSAIDs is that they block Cox-1"
Cox, cyclooxygenase - either of two related enzymes that control the production of prostaglandins and are blocked by aspirin
Based on WordNet 3.0, Farlex clipart collection. © 2003-2012 Princeton University, Farlex Inc.
References in periodicals archive ?
Indomethacin, an inhibitor of both cyclooxygenase-1 (constitutively expressed) and cyclooxygenase-2 (induced during inflammation), abolishes this effect and links the activity of cyclooxygenases to the function of detrusor muscle [42].
Primer GenBank Sense primer name (5' [right arrow] 3') COX-1 NM_001271368.1 GACCCGCCTCATCCTCATAG-3 COX-2 NM_006662.2 CAAAAGCTGGGAAGCCTTCT GAPDH NM_001289746.1 GACCACTTTGTCAAGCTCATTTCC Primer Anti-sense primer name (5' [right arrow] 3') COX-1 CCACCGA TCTTGAAGGAGTCA COX-2 CCATCCTTGAAAAGGCGCAG GAPDH TGAGGGTCTCTCTCTTCCTCTTGT COX-1: cyclooxygenase-1; COX-2: cyclooxygenase-2; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
Ginger suppresses prostaglandin synthesis through inhibition of cyclooxygenase-1 and cyclooxygenase-2 thereby its usefulness in arthritis was understood.
Crypt stem cell survival in the mouse intestinal epithelium is regulated by prostaglandins synthesized through cyclooxygenase-1. J.
Cyclooxygenase-1 and cyclooxygenase-2 selectivity of widely used nonsteroidal anti-inflammatory drugs.
Levine, "Expression of cyclooxygenase-1 and cyclooxygenase-2 in human breast cancer," Journal of the National Cancer Institute, vol.
3D model from PDB ID: 1PTH was obtained from SWISS-MODEL repository for cyclooxygenase-1 (COX-1) (http://www.rcsb.org/pdb/explore/explore .do?structureId=1pth) and 3D model from PDB ID: 6COX for cyclooxygenase-2 (COX-2) [13].
Identification and functional analysis of cyclooxygenase-1 as a molecular target of boswellic acids.
Molecular identification of cytosolic prostaglandin E2 synthase that is functionally coupled with cyclooxygenase-1 in immediate prostaglandin E2 biosynthesis.
If they ingest a cyclooxygenase-1 inhibitor, they develop asthma symptoms, rhinorrhea, periorbital edema, urticaria, pruritus, angioedema, anaphylaxis, or other symptoms.

Full browser ?